Raltegravir

Für quantitative Strangtransferassays wird Donor-DNA-Substrat durch Annealing von HPLC-qualifizierten Oligonukleotiden 5′-GACTCACTATAGGGCACGCGTCAAAATTCCATGACA und 5′-ATTGTCATG GAATTTTGACGCGTGCCCTATAGTGAGTC gebildet. Reaktionen (40 μL) enthalten 0,75 μM PFV IN, 0,75 μM Donor-DNA, 4 nM (300 ng) supercoiled pGEM9-Zf(−) Ziel-DNA, 125 mM NaCl, 5 mM MgSO₄, 4 μM ZnCl₂, 10 mM DTT, 0,8 % (Vol/Vol) DMSO und 25 mM BisTris propan–HCl, pH 7,45. Raltegravir wird in den angegebenen Konzentrationen hinzugefügt. Die Reaktionen werden durch Zugabe von 2 μL PFV IN, verdünnt in 150 mM NaCl, 2 mM DTT und 10 mM Tris-HCl, pH 7,4, initiiert und nach 1 Stunde bei 37 °C durch Zugabe von 25 mM EDTA und 0,5 % (Gew./Vol.) SDS gestoppt. Reaktionsprodukte, deproteinisiert durch Digestion mit 20 μg Proteinase K für 30 Minuten bei 37 °C, gefolgt von Ethanolfällung, werden in 1,5%igen Agarosegelen getrennt und durch Färbung mit Ethidiumbromid sichtbar gemacht. Integrationsprodukte werden mittels quantitativer Echtzeit-PCR unter Verwendung von Platinum SYBR Green qPCR SuperMix und drei Primern quantifiziert: 5′-CTACTTACTCTAGCTTCCCGGCAAC, 5′-TTCGCCAGTTAATAGTTTGCGCAAC und 5′-GACTCACTATAGGGCACGCGT. PCR-Reaktionen (20 μL) enthielten 0,5 μM jedes Primers und 1 μL verdünntes Integrationsreaktionsprodukt. Nach einem 5-minütigen Denaturierungsschritt bei 95 °C werden 35 Zyklen in einem CFX96 PCR-Instrument durchgeführt, wobei 10 Sekunden Denaturierung bei 95 °C, 30 Sekunden Annealing bei 56 °C und 1 Minute Extension bei 68 °C erfolgen. Standardkurven werden unter Verwendung von Seriendilutionen der WT PFV IN-Reaktion in Abwesenheit dieser Verbindung erstellt.

Human MT-4 cells

0.0001-1 μM

5 days

Human MT-4 cells are infected for 2 hours with the SIVmac251, HIV-1 (IIIB) and HIV-2 (CDC 77618) stocks at a multiplicity of infection of, approximately, 0.1. Cells are then washed three times in phosphate buffered saline, and suspended at 5 × 10⁵/mL in fresh culture medium (to primary cells 50 units/mL of IL-2 are added) in 96-well plates, in the presence or absence of a range of triplicate raltegravir concentrations (0.0001 μM -1 μM). Untreated infected and mock-infected controls are prepared too, in order to allow comparison of the data derived from the different treatments. Viral cytopathogeniciy in MT-4 cells is quantitated by the methyl tetrazolium (MTT) method (MT-4/MTT assay) when extensive cell death in control virus-infected cell cultures is detectable microscopically as lack of capacity to re-cluster. The capability of MT-4 cells to form clusters after infection. Briefly, clusters are disrupted by pipetting; and, after 2 hours of incubation at 37 °C, the formation of new clusters is assessed by light microscopy (100 × magnification). Cell culture supernatants are collected for HIV-1 p24 and HIV-2/SIVmac251 p27 core antigen measurement by ELISA. In CEMx174-infected cell cultures, which show a propensity to form syncytia induced by the virus envelope glycoproteins, syncytia are counted, in blinded fashion, by light microscopy for each well at 5 days following infection.

Indian Rhesus macaques

50 mg/kg or 100 mg/kg

Oral administration